View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_114 (Length: 203)
Name: NF1720_high_114
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_114 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 4642931 - 4643104
Alignment:
| Q |
16 |
atttaattgatctcagtatttacttattactttgtatcccttgctttttcttgactgtttaagttggtaattctggtttatgcgatttcattctctttag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642931 |
atttaattgatctcagtatttacttattactttgtatcccttgctttttcttgactgtttaagttggtaattctggtttatgcgatttcattctctttag |
4643030 |
T |
 |
| Q |
116 |
gctgcaaaggtgttcttcacagctccttgtttattgtgggagagataggaggcaatgactatggttttcctttg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643031 |
gctgcaaaggtgttcttcacagctccttgtttattgtgggagagataggaggcaatgactatggttttcctttg |
4643104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University