View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_33 (Length: 367)
Name: NF1720_high_33
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_33 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 38316112 - 38315987
Alignment:
| Q |
1 |
agagcaaggtaacatcgatctaacttcgtaactcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctga |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38316112 |
agagcaaggtaacatcgatctaaattcgtaactcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctga |
38316013 |
T |
 |
| Q |
101 |
gattacgtttattttagttccgatta |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38316012 |
gattacgtttattttagttccgatta |
38315987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 262 - 357
Target Start/End: Complemental strand, 38315851 - 38315756
Alignment:
| Q |
262 |
gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatcttgctttcaaacggtggatttgttcctttg |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38315851 |
gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatcttgctttcaaacggtggatttgttcctttg |
38315756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 208 - 237
Target Start/End: Complemental strand, 38315905 - 38315876
Alignment:
| Q |
208 |
gtagtttgtttcgagtgttattcagcttaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38315905 |
gtagtttgtttcgagtgttattcagcttaa |
38315876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 310 - 357
Target Start/End: Complemental strand, 45144 - 45097
Alignment:
| Q |
310 |
gaggttgttatttgcatcttgctttcaaacggtggatttgttcctttg |
357 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45144 |
gaggttgttattcacattttgctttcaaacggtggatttgttcctttg |
45097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University