View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_40 (Length: 355)
Name: NF1720_high_40
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 324; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 17 - 344
Target Start/End: Original strand, 4641919 - 4642246
Alignment:
| Q |
17 |
atttgtgtcctgcagaagtttagactctaaaagatgctttctgcaaaggattcatttgtctttcaatttgtgaaaatctagtactaagcgaagtcaatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4641919 |
atttgtgtcctgcagaagtttagactctaaaagatgctttctgcaaaggattcatttgtctttcaatttgtgaaaatctagtactaagcgaagtcaatct |
4642018 |
T |
 |
| Q |
117 |
catcatatgtgttactcgtatttatcatggttctgccttgatcttatgatttatatgctgtaattgatctttttaaatagttaaaatggttctgccttga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642019 |
catcatatgtgttactcgtatttatcatggttctgccttgatcatatgatttatatgctgtaattgatctttttaaatagttaaaatggttctgccttga |
4642118 |
T |
 |
| Q |
217 |
tcatatgatttataacctcgtgcgtccatctgaattgcaggtgagtataagctgccctgatggaggtttcaaatttctcgagaatgcaaaagacttgcca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642119 |
tcatatgatttataacctcgtgcgtccatctgaattgcaggtgagtataagctgccctgatggaggtttcaaatttctcgagaatgcaaaagacttgcca |
4642218 |
T |
 |
| Q |
317 |
accattagtaagtacacaaccgagccta |
344 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4642219 |
accattagtaagtacacaaccgagccta |
4642246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 332
Target Start/End: Original strand, 41031903 - 41031957
Alignment:
| Q |
278 |
ggaggtttcaaatttctcgagaatgcaaaagacttgccaaccattagtaagtaca |
332 |
Q |
| |
|
||||| |||| ||||||||||||||| || ||||| |||||||| |||||||||| |
|
|
| T |
41031903 |
ggaggcttcagatttctcgagaatgccaaggacttaccaaccatcagtaagtaca |
41031957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University