View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_52 (Length: 326)
Name: NF1720_high_52
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_52 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 270
Target Start/End: Original strand, 30354996 - 30355251
Alignment:
| Q |
14 |
gagatgaagtttggaggtcattgttttcaagaggaggaactagaagttttgtcacaagcttgctggtaaagttcttgttgtggttttttaatgttgtgtg |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30354996 |
gagatgaagcttggaggtcattgttttcaagaggaggaactagaagttttgtcacaagcttgctggtaaagttcatgttgtggttttttaatgttgtgtg |
30355095 |
T |
 |
| Q |
114 |
attagcttctgatgttgagttttagatctataagtttgggttagctattggtcatgggatgttttctggagtctgctttgtttcctccttgnnnnnnnnn |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30355096 |
attagcttatgatgttgagttttagatctacaagtttgggttaactattggtcatgggatgttttctgtggtctgctttgtttcctccttg-tttttttt |
30355194 |
T |
 |
| Q |
214 |
gttctcgggagttgttgtgtggtgcagaaggttatgcctattatggttttcatatgc |
270 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355195 |
gttctcgggagttgttgtggtgtgcagaaggttatgcctattatggttttcatatgc |
30355251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 14 - 103
Target Start/End: Original strand, 30357407 - 30357496
Alignment:
| Q |
14 |
gagatgaagtttggaggtcattgttttcaagaggaggaactagaagttttgtcacaagcttgctggtaaagttcttgttgtggtttttta |
103 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||| | |||||| | ||||| | || ||||| |||||||||||||||||| |
|
|
| T |
30357407 |
gagatgaagtttggagttcattgttttcaagagttggaacaaagagttttattgcaagcattttgataaaggtcttgttgtggtttttta |
30357496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 15 - 65
Target Start/End: Original strand, 30371060 - 30371110
Alignment:
| Q |
15 |
agatgaagtttggaggtcattgttttcaagaggaggaactagaagttttgt |
65 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
30371060 |
agatgaagcttggaggtcaatgttttcaagaggtggaataagaagttttgt |
30371110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University