View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_94 (Length: 236)
Name: NF1720_high_94
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_94 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 37557115 - 37556880
Alignment:
| Q |
1 |
tatagaatttttgcatagatcttttcgacttgagcagataacattgcattgttgccttccaatttcagtgcagagacaacttcagcccatttgttttgaa |
100 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37557115 |
tatagaagtgttgcatagatcttttcgacttgagcagataacattgcattgttgccttccaatttcagtgcagagacaacttcagtccatttgttttgaa |
37557016 |
T |
|
| Q |
101 |
gaccaacctggacaaagtcaaaagaatccataacaatatattaaatttgaaccattcatatgataataatacatatgaaaattacttaattaaaagcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37557015 |
gaccaacctggacaaagtcaaaagaatccataacaatatattaaatttgaaccattcatatgataataatacatatgaaaattacttaattaaaagcctc |
37556916 |
T |
|
| Q |
201 |
tcttgactaatttatattatatagacacaacatatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37556915 |
tcttgactaatttatattatatagacacaacatatt |
37556880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 236
Target Start/End: Complemental strand, 41552232 - 41552171
Alignment:
| Q |
169 |
atacatatgaaaattacttaattaaaagcctctcttgactaatttatattatatagacacaacatatt |
236 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
41552232 |
atacatatgaaaattacttaa----aagcctctcttgactaatttagat--tatagacacaacatatt |
41552171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University