View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_high_97 (Length: 234)
Name: NF1720_high_97
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_high_97 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 82 - 212
Target Start/End: Original strand, 25868318 - 25868447
Alignment:
| Q |
82 |
gatgatagtggaacgatattggtgagactcattatctcattatctttagaaagtgggaaatatacnnnnnnnnnntggaaaaatctcacattttttagac |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25868318 |
gatgatagtggaacgatattggtgagactcattatctcattatctttagaaagtgggaaatatac-aaaaaaaaatggaaaaatctcacattttttagac |
25868416 |
T |
 |
| Q |
182 |
aagtattttgtgaagattcttttaaaatgat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25868417 |
aagtattttgtgaagattcttttaaaatgat |
25868447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 25868188 - 25868240
Alignment:
| Q |
1 |
aaaaaataaaagtgaaatgatgag-aaaaattattagtacagttgtggtaaac |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
25868188 |
aaaaaataaaagtgaaatgatgagaaaaaaatattagtacagttgtggtaaac |
25868240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University