View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_low_100 (Length: 230)
Name: NF1720_low_100
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 13715261 - 13715066
Alignment:
| Q |
20 |
tatggtagatttttgtgttacccaactgttcaaaacctcttgcagtgcgtctattcctcactcgttttttgaagttgtttggtcccctccttgcccggtt |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13715261 |
tatggtagacttttgtgttacccaactgttcaaaacctcttgcagtgcgtctattccttactcgttttttgaagttgtttggtcccctccttgcctggtt |
13715162 |
T |
 |
| Q |
120 |
gggtcaagtttaacctggatggatctatggtggctaannnnnnnaagtttgccactattggaattgcttgtagagatagtaatgctcactttctttga |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715161 |
gggtcaagtttaatctggatggatctatggtgggtaacccccc--agtctgctactattggaattgcttgtagagatagtaatgctcactttctttga |
13715066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University