View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1720_low_111 (Length: 214)

Name: NF1720_low_111
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1720_low_111
NF1720_low_111
[»] chr1 (1 HSPs)
chr1 (18-200)||(37945530-37945708)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 37945708 - 37945530
Alignment:
18 tataggtgaggaaataacttccattcatgaataaatataacaagatgaacattaattggtaagtatgattgttcgttagcnnnnnnnaataatttattca 117  Q
    ||||||| |||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||       |||||||||||||    
37945708 tataggtcaggaaataacttccattcatgaata----taacaagatgaacattaattggtaagtatgattgttcgttagctttttttaataatttattca 37945613  T
118 agcttctcaaattagtttaaaatataacgaaataattgaggacgaacggtgaatgagcttcatcaatgtcgaattgttcagaa 200  Q
    ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||    
37945612 agcttctcaaattagtttaaaatataaagaaataattgaggactaacggtgaatgagcttcatcaatgtcaaattgtttagaa 37945530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University