View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_low_111 (Length: 214)
Name: NF1720_low_111
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_low_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 37945708 - 37945530
Alignment:
| Q |
18 |
tataggtgaggaaataacttccattcatgaataaatataacaagatgaacattaattggtaagtatgattgttcgttagcnnnnnnnaataatttattca |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37945708 |
tataggtcaggaaataacttccattcatgaata----taacaagatgaacattaattggtaagtatgattgttcgttagctttttttaataatttattca |
37945613 |
T |
 |
| Q |
118 |
agcttctcaaattagtttaaaatataacgaaataattgaggacgaacggtgaatgagcttcatcaatgtcgaattgttcagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
37945612 |
agcttctcaaattagtttaaaatataaagaaataattgaggactaacggtgaatgagcttcatcaatgtcaaattgtttagaa |
37945530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University