View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_low_112 (Length: 214)
Name: NF1720_low_112
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_low_112 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 21400298 - 21400495
Alignment:
| Q |
1 |
gacaattcctttgctaccttgtctatgaatatcaaattgacattaagaaactggcaagtataacacatcatgtagaactatggagctaatgatatgcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400298 |
gacaattcctttgctaccttgtctatgaatatcaaattgacaataagaaactggcaagtataacacatcatgtagaactatggagctaatgatatgcaca |
21400397 |
T |
 |
| Q |
101 |
attccaaccatttctgccattgcataattaccattagacaacttaacttgtgttcctttaattcttttataagaaatgaaacacatccatgtaaaaac |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400398 |
attccaaccatttctgctattgcataattaccattagacaacttaacttgtgttcctttaattcttttataagaaatgaaacacatccatgtaaaaac |
21400495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University