View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_low_56 (Length: 316)
Name: NF1720_low_56
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 13 - 302
Target Start/End: Original strand, 8857728 - 8858020
Alignment:
| Q |
13 |
tgaactgtacatttccatctatcttctatcacatttttgaaaggtaaattcggagaggatgaaagtagtag---cttatagaatcatgagctgttcttgc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8857728 |
tgaactgtacatttccatctatcttctatcacatttttgaaaggtaaattcagagaggatgaaagtagtagtagcttatagaatcatgagctgttcttgc |
8857827 |
T |
|
| Q |
110 |
ataagctacataccnnnnnnnncctctttggagagcgtggggaggtaaagcattattggagcaccaaccaacatatcttaagatggtgatgttttatttt |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8857828 |
ataagctacataccttttttttcctctttggagagcgtggggaggtaaagcattattggagcaccaaccaacatatcttaagatggtgatgttttatttt |
8857927 |
T |
|
| Q |
210 |
aaatatgttctcaaaattttcaatggtcatccaagttttggtagcgaatcaaatgctacttttgtgcgcataccattccactcttatgatgat |
302 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8857928 |
aaatatgttctcaaatttttcaatggtcatccaagttttggtagcgaatcaaatgctacttttgtgcgcataccattccactcttatgatgat |
8858020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University