View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1720_low_72 (Length: 275)
Name: NF1720_low_72
Description: NF1720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1720_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 8018792 - 8019029
Alignment:
| Q |
1 |
tacaattaggtttacctatatacattcatgtgttttttaaccttaaacaacttgtgaaagaaggataagnnnnnnn-gtcatcagatgcacattatgttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8018792 |
tacaattaggtttacctatatacattcatgtgttttttaaccttaacaaacttgtgaaagaaggataagttttttttgtcatcagatgcacattatgttt |
8018891 |
T |
 |
| Q |
100 |
gaaaatagtcaatttaaaataaagctacaagttactactccatattttctttgttatacccaatatttaatcataatacattggaaaattgaacnnnnnn |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8018892 |
gaaaatagtcaatttaaaat-------------------ccatattttctttgttatacccaatatttaatcataatacattggaaaattgaacaaaaaa |
8018972 |
T |
 |
| Q |
200 |
ntatataattagattgcatggccctagtattatcccaagttttctctcccataatca |
256 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8018973 |
atataaaattagattgcatggccttagtattatcccaagttttctctcccataatca |
8019029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University