View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_high_12 (Length: 364)
Name: NF17210_high_12
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 43870017 - 43869972
Alignment:
| Q |
19 |
atccagtcgtgaaacatatttcgctatacatagcattattcttttt |
64 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43870017 |
atccagtcgtaaaacatatttcgctatacatagcattattcttttt |
43869972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University