View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17210_high_12 (Length: 364)

Name: NF17210_high_12
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17210_high_12
NF17210_high_12
[»] chr7 (1 HSPs)
chr7 (19-64)||(43869972-43870017)


Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 43870017 - 43869972
Alignment:
19 atccagtcgtgaaacatatttcgctatacatagcattattcttttt 64  Q
    |||||||||| |||||||||||||||||||||||||||||||||||    
43870017 atccagtcgtaaaacatatttcgctatacatagcattattcttttt 43869972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University