View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_high_17 (Length: 323)
Name: NF17210_high_17
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 102 - 321
Target Start/End: Complemental strand, 14396411 - 14396193
Alignment:
| Q |
102 |
ctgatttactctccaaattccannnnnnncattgtggcaagacatctatctgttagtctgaagctccatcttaatcatgttcaacaactattggatgtgt |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396411 |
ctgatttactctccaaattccatttttt-cattgtggcaagacatctatctgttagtctgaagctccatcttaatcatgttcaacaactattggatgtgt |
14396313 |
T |
 |
| Q |
202 |
ttggattttatgttaagaattcaagtttcctttcaaattggattcttatatcactttccattttgttgcttccctaagtcactttaaggattccatattg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396312 |
ttggattttatgttaagaattcaagtttcctttcaaattggattcttatatcactttccattttgttgcttccctaagtcactttaaggattccatattg |
14396213 |
T |
 |
| Q |
302 |
tttgcacttcttgtgtttct |
321 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14396212 |
tttgcacttcttgtgtttct |
14396193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University