View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_high_31 (Length: 217)
Name: NF17210_high_31
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 48592086 - 48591899
Alignment:
| Q |
12 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcgacttcttgtttctctttaagtaagagagaagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48592086 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcaacttcttgtttctctttaagtaagagagaagc |
48591987 |
T |
 |
| Q |
112 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaatcatattggtttattcgttttgaatgcacaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48591986 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaatcatattggtttattcactttgaatgcacaatt |
48591899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 48601781 - 48601594
Alignment:
| Q |
12 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcgacttcttgtttctctttaagtaagagagaagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48601781 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcaacttcttgtttctctttaagtaagagagaagc |
48601682 |
T |
 |
| Q |
112 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaatcatattggtttattcgttttgaatgcacaatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48601681 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaatcatattggtttattcactttgaatgcacaatt |
48601594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 23232246 - 23232421
Alignment:
| Q |
12 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggtggtaatcgtgcatgcgacttcttgtttctctttaagtaagagagaagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||| ||| || || |||||||||||||| ||| |||| ||| |
|
|
| T |
23232246 |
gagatgaagatgtccaattattggtattgttggtggacttggagg--gagg-ggtaaatgtggttgtgatttcttgtttctcttaaagacggagaaaagt |
23232342 |
T |
 |
| Q |
112 |
tgaaaaatgaaaagaaataggagcaaaatcatagctaatgagaaggaatgggaaatcatattggtttattcgttttgaa |
190 |
Q |
| |
|
| | || |||||||| ||||||| ||||||||||||| |||||||||| |||||||| ||| |||||| | |||||| |
|
|
| T |
23232343 |
gggagaaggaaaagaagaaggagcacaatcatagctaataagaaggaatgagaaatcatcttgttttattagctttgaa |
23232421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 63
Target Start/End: Original strand, 23224913 - 23224964
Alignment:
| Q |
12 |
gagatgaagatgtccaattattggtattgctggtggacttggagggtgaggt |
63 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
23224913 |
gagatgaagatgaccaattattggtattgctagtggacttggagggtaaggt |
23224964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University