View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_high_32 (Length: 214)
Name: NF17210_high_32
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 40965707 - 40965906
Alignment:
| Q |
1 |
gatgatgttgaatttgaagacggtaggtagaactgaactactatgagtttcttaactacttttttcgatatactttaattaannnnnnnn--atacagag |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
40965707 |
gatgatgttgaatttgaagacggtaggtagaactgaactactatgagtttcttaactacttttttcgatatactttaattgattttttttttatacagag |
40965806 |
T |
|
| Q |
99 |
accgaaatggatgaggatagcgtcgagttctatgacgaagaagaggaggatagtgtgccctatgtaagttttgatggaaaactcatttttgcatacatat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40965807 |
accgaaatggatgaggatagcgtcgagttctatgacgaagaagaggaggatagtgtgccctatgtaagttttgatggaaaactcaattttgcatacatat |
40965906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University