View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_low_11 (Length: 394)
Name: NF17210_low_11
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 349
Target Start/End: Original strand, 34810140 - 34810470
Alignment:
| Q |
13 |
gataatacttttactccgatggtgatttcgccggtgaagcttggtgctgatgttgttgttcatagtatctccaagtacatcagtggtggggcagatataa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810140 |
gataatacttttactccgatggtgatttcgccggtgaagcttggtgctgatgttgttgttcatagtatctccaagtacatcagtggtggggcagatataa |
34810239 |
T |
|
| Q |
113 |
ttgcaggtttgtttgtctttttgccatgttcttcttagttctttctttgtcgattatgaaacatacttaacacgtatctatgataaagtactataaatac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810240 |
ttgcaggtttgtttgtctttttgccatgttcttcttagttctttctttgtcgattatgaaacatacttaacacgtatctatgataaagtactataaatac |
34810339 |
T |
|
| Q |
213 |
acacnnnnnnnnnnnnnnnnnnnnacttgtctctttcatgatatgaagtaaacatttatcacttacatgtacgtgtatatatactaaatttaaattattc |
312 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34810340 |
acacttttttgtttttaagtttttacttgtctctttcatgatatgaagtaaacatttatcacttacatgtacgtgtatatatac------taaattattc |
34810433 |
T |
|
| Q |
313 |
aagttgtaactgttttttaattctttcaaaaagaatg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810434 |
aagttgtaactgttttttaattctttcaaaaagaatg |
34810470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University