View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_low_24 (Length: 253)
Name: NF17210_low_24
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 121 - 237
Target Start/End: Complemental strand, 30855178 - 30855062
Alignment:
| Q |
121 |
catgatgttcgtgttagccaaataacttagttgggtacttttttaaaaagatgatttgtaattttgtgacaatactcacaactaacttgatctagctatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30855178 |
catgatgttcgtgttagccaaataacttagttgggtacttttttaaaaagatgatttgtaattttgtgacaatactcacaactaacttgatctagctatt |
30855079 |
T |
|
| Q |
221 |
gcacaaagtcaaaaact |
237 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
30855078 |
gcacaaagtcaaaaact |
30855062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 30855291 - 30855256
Alignment:
| Q |
8 |
tgtccaagaatataaaaccattgtaacattttaccc |
43 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30855291 |
tgtccaaaaatataaaaccattgtaacattttaccc |
30855256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University