View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_low_25 (Length: 246)
Name: NF17210_low_25
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 14396100 - 14395919
Alignment:
| Q |
1 |
tgaccaaatcatgttgtgttgcttctatatggtcgcacaggtttctcttttaactttgaaaacatgagagtgcattgtgcttcatttaccattttctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396100 |
tgaccaaatcatgttgtgttgcttctatatggtcgcacaggtttctcttttaactttgaaaacatgagagtgcattgtgcttcatttaccattttctcat |
14396001 |
T |
 |
| Q |
101 |
tctattttgatcattatgttgggagcagtcagaataaatggcatggttgaaaagctacaactatctcagcagacaggagagaatgtataccatct |
195 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14396000 |
tctattttgatcattatattgggagcagtcagaata-------------aaaagctacaactatctcagcagacacgagagaatgtataccatct |
14395919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 212
Target Start/End: Complemental strand, 15099730 - 15099636
Alignment:
| Q |
118 |
gttgggagcagtcagaataaatggcatggttgaaaagctacaactatctcagcagacaggagagaatgtataccatctcttccagggaatcctaa |
212 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||| |||||||||||| | | |||||||||||| ||| |||||| ||||||||| |
|
|
| T |
15099730 |
gttgggagcagtcagaataagcggaatggttgaaaggctacaattatctcagcagataagggagaatgtatactctcttttccagcgaatcctaa |
15099636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University