View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_low_27 (Length: 235)
Name: NF17210_low_27
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 46890566 - 46890359
Alignment:
| Q |
16 |
ctgccttccaaattattagtttcaatggttattgcggagcactctctcgatttcaaggaatcatccctaaactgtgcaggatcttcatgaaggaatatac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46890566 |
ctgccttccaaattattagtttcaatggttattgcggagcactctctcaatttcaaggaatcatccctaaactgtgcaggatcttcatgaaggaatatac |
46890467 |
T |
 |
| Q |
116 |
agttatctccatatggacattcctccccattccaataattcttgcacagtttcatcgtttgtatgannnnnnnatcttcaccatgatttcccagctgcat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
46890466 |
agttatctccatatggacattcctccccattgcaataattcttgcacagtttcattgtttgtatgatttttttatctttagcatgatttcccagctgcat |
46890367 |
T |
 |
| Q |
216 |
ccgacctt |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
46890366 |
ccgacctt |
46890359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 80 - 171
Target Start/End: Complemental strand, 46873180 - 46873089
Alignment:
| Q |
80 |
ccctaaactgtgcaggatcttcatgaaggaatatacagttatctccatatggacattcctccccattccaataattcttgcacagtttcatc |
171 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| ||||||||||| ||||||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
46873180 |
ccctaaattgtgcaggatcttcatgaaggaatttacacttatctccatagggacatttctccccattgcaatacttcttgcacagtttcatc |
46873089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 171
Target Start/End: Complemental strand, 46899109 - 46898982
Alignment:
| Q |
44 |
ttattgcggagcactctctcgatttcaaggaatcatccctaaactgtgcaggatcttcatgaaggaatatacagttatctccatatggacattcctcccc |
143 |
Q |
| |
|
||||||| || |||||||| | |||| | ||| ||||||||||| |||||||| |||||||| || |||| ||||| ||||| ||||||||||| || |
|
|
| T |
46899109 |
ttattgcagaacactctcttgttttccaagaagcatccctaaacctagcaggatcctcatgaagaaagctacacttatcaccataaggacattcctcacc |
46899010 |
T |
 |
| Q |
144 |
attccaataattcttgcacagtttcatc |
171 |
Q |
| |
|
| | |||| ||||| ||||| |||||| |
|
|
| T |
46899009 |
aatgtaatacttcttacacagcttcatc |
46898982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University