View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_low_28 (Length: 230)
Name: NF17210_low_28
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 42393015 - 42392805
Alignment:
| Q |
16 |
aaattgttcaaaacttcaatattgttaagaatagcaattcaatgagcttctacttacggagagcaccatttatcattgctggagtttttaacaattttca |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
42393015 |
aaattgttcaaaacttcaatgttgttaagaatagcaattcaacgagcttctacttacggagagcaccattgatcattgctagagtttttaacaattttca |
42392916 |
T |
|
| Q |
116 |
agtatttgtctgacatacaccatatgagacacttctctaccctagaaaccacctatcatatgaatattgatcaagggaatctagattcagcactcaatgc |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42392915 |
agtatttgtctaacatacaccatatgagacacttctctaccctagaaaccacctatcatatgaatattgatcaagggaatctagattcagcgctcaatgc |
42392816 |
T |
|
| Q |
216 |
tagtataatct |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
42392815 |
tagtataatct |
42392805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University