View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17210_low_6 (Length: 530)
Name: NF17210_low_6
Description: NF17210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17210_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 7400954 - 7401148
Alignment:
| Q |
19 |
ggtttagcaatagatggaccagataaagatcaaacacatattacaactcgtgtgatgggtacacatggatatgctgctcctgaatatatcaatacaggta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7400954 |
ggtttagcaatagatggaccagataaagatcaaacacatattacaactcgtgtgatgggtacacatggatatgctgctcctgaatatatcaatacaggta |
7401053 |
T |
|
| Q |
119 |
tattctaatctatagtcaaaatcaattaaacctaccccttcaattttcatttaggcttaaatatatttttattctttaaaataagatatctaatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7401054 |
tattctaatctatagtcaaaatcaattaaacctacccctttaattttcatttaggcttaaatatatttttattctttaaaataagataactaatg |
7401148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 269 - 392
Target Start/End: Original strand, 7401203 - 7401325
Alignment:
| Q |
269 |
aaagatgatcacaattgtctggcttttatactcttatagtcaactttttgggatttggattgtgtgaggtgagtgtatgcagctagcagcgtctacatgg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7401203 |
aaagatgatcacaattgtctggcttttatactcttatagtcaactttt-gggatttggattgtgtgaggtgagtgtatgcagctagcagcgtctacatgg |
7401301 |
T |
|
| Q |
369 |
tccgatcaagatcatatggtctaa |
392 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7401302 |
tccgatcaagatcatatggtctaa |
7401325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 405 - 517
Target Start/End: Original strand, 7401369 - 7401472
Alignment:
| Q |
405 |
atgtttttaaaatcgaatatagggaacttgaaatatgaactatatatgatcttgatcgaacggtccacatgtttagtgacaagacacga--aagtctcaa |
502 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7401369 |
atgtttttaaaatcgaatatagggaacttgaaatat-----------gatcttgatcgaacggtccacatgtttagtgacaagacacgatcaagtctcaa |
7401457 |
T |
|
| Q |
503 |
cttttcttctttctt |
517 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7401458 |
cttttcttctttctt |
7401472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University