View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17211_high_25 (Length: 248)
Name: NF17211_high_25
Description: NF17211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17211_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 231
Target Start/End: Original strand, 33172552 - 33172770
Alignment:
| Q |
13 |
gagatcaactttttatgtcaaaaaacatttttatttacaaaattacgtaacattaaataaattaggtggaagagatccataattagatgaactcttattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33172552 |
gagatcaactttttatgtcaaaaaacatttttatttacaaaattacgtaacatttaataaattaggtggaagagatccataattagatgaactcttattt |
33172651 |
T |
 |
| Q |
113 |
gagaacaaataacatttctatctctcatgcgttttggttaaaaaccgttccctagagtgctaagaatggatcttgatggatctcgtggacatgccagtag |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| | |
|
|
| T |
33172652 |
gagaacaaataacatttctacctctcatgcgttttggttaaaaaccgttccctagagtgctaagaatggatcttgatggatctcatggacatgctagtgg |
33172751 |
T |
 |
| Q |
213 |
ttcttcggcttctagaggt |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33172752 |
ttcttcggcttctagaggt |
33172770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University