View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17211_low_13 (Length: 320)
Name: NF17211_low_13
Description: NF17211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17211_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 58 - 264
Target Start/End: Original strand, 39335971 - 39336175
Alignment:
| Q |
58 |
ctttgcacatcacaagaagctcgtgtaattcactgttttagtttcctcgaaagaaaggacgtatgtttaatgatttggatgggatgaaagagacatttaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39335971 |
ctttgcacatcacaagaagctcgtgtaattc--tgttttagtttcctcgaaagaaaggacgtatgtttaatgatttgggtgggatgaaagagacatttaa |
39336068 |
T |
 |
| Q |
158 |
gaaactgaagatgatttttgcaccaaataggtacctttggttcctcatctcttttccctgcttagttattttacttcatatcatgttgtgcattcaatca |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39336069 |
gaaactgaagatgatttttgcaccaaataggtacctttggttcctcatctcttttccctgcttagttattttacttcatatcatgttgtgcattcaatca |
39336168 |
T |
 |
| Q |
258 |
atttctc |
264 |
Q |
| |
|
||||||| |
|
|
| T |
39336169 |
atttctc |
39336175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University