View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17211_low_23 (Length: 266)
Name: NF17211_low_23
Description: NF17211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17211_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 4 - 256
Target Start/End: Complemental strand, 2171289 - 2171037
Alignment:
| Q |
4 |
cttttagagtaaatacttcattaaatttcacaaaaccaatttcattcaaaaacatttgcgacaaactctcacttattgacacattattttgcagttatgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2171289 |
cttttagagtaaatacttcattaaatttcacaaaaccaatttcattcaaaaacatttgtgacaaactctcacttattgacacattattttgcagttatgt |
2171190 |
T |
 |
| Q |
104 |
tctgaaaaatgaaaaggctgatgtttatcggttaccttatctggcaagcagtggacctggatttggttagtgacataattttgatagcttgaattttctg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2171189 |
tctgaaaaatgaaaaggctgatgtttatcggttaccttatctggcaagcggtggacctggatttggttagtgacataattttgatagcttgaattttctg |
2171090 |
T |
 |
| Q |
204 |
aatgtgtttgttgtcaaaatatgataataataggattgttcataggacctatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2171089 |
aatgtgtttgttgtcaaaatatgataataataggattgttcataggacctatg |
2171037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University