View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17211_low_28 (Length: 226)
Name: NF17211_low_28
Description: NF17211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17211_low_28 |
 | |
|
| [»] scaffold0060 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 86 - 220
Target Start/End: Original strand, 8444349 - 8444483
Alignment:
| Q |
86 |
gttcaggctggttattagcaattgagttttaagaaatgtagtgattgatgaaatattaggactcaagctgtaattgatgttgttttcacaatggaagagc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8444349 |
gttcaggctggttattagcaattgagttttaagaaatgtagtgtttgatgaaatattaggactcgagctgtaattgatgttgttttcacaatggaagagc |
8444448 |
T |
|
| Q |
186 |
attacatttcttcacacattgccaaaacagaaagt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8444449 |
attacatttcttcacacattgccaaaacagaaagt |
8444483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 8444112 - 8444199
Alignment:
| Q |
1 |
cacacaaaatcaacacattaccaagnnnnnnnaatctttgtgaaattggtcaatttttaatgtccaggtgataatgctaataattgtt |
88 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8444112 |
cacacaaaatcaacacattaccaagtttttttaacctttgtgaaattggtcaatttttaatgtccaggtgataatactaataattgtt |
8444199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 153 - 220
Target Start/End: Original strand, 8402782 - 8402849
Alignment:
| Q |
153 |
ctgtaattgatgttgttttcacaatggaagagcattacatttcttcacacattgccaaaacagaaagt |
220 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
8402782 |
ctgtaattgatgtttttttcacagtggaagagcaatacatttcttaacacattgccaaaacacaaagt |
8402849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 86 - 214
Target Start/End: Complemental strand, 65564 - 65436
Alignment:
| Q |
86 |
gttcaggctggttattagcaattgagttttaagaaatgtagtgattgatgaaatattaggactcaagctgtaattgatgttgttttcacaatggaagagc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65564 |
gttcaggctggttattagcaattgagttttaagaaatgcaatgtttgatgaaatgttaggactcaagctgtaattgatgttgttttcacaatggaagagc |
65465 |
T |
|
| Q |
186 |
attacatttcttcacacattgccaaaaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
65464 |
attacatttcttcacacattgccaaaaca |
65436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 52 - 88
Target Start/End: Complemental strand, 66167 - 66131
Alignment:
| Q |
52 |
aatttttaatgtccaggtgataatgctaataattgtt |
88 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
66167 |
aatttttaatgtccaggtgataatactaataattgtt |
66131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University