View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17212_high_1 (Length: 253)
Name: NF17212_high_1
Description: NF17212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17212_high_1 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 9832706 - 9832948
Alignment:
| Q |
11 |
gaagcaaaggcggtaagcatttaaagtcatttgcgtacatttcatttttcaggacaagttctgatgttggtttttgtgtgggatgttttcatgtgtttat |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832706 |
gaagccaaggcggtaagcatttaaagtcatttgcgtacatttcatttttcaggaaaagttctgatgttggtttttgtgtgggatgttttcatgtgtttat |
9832805 |
T |
|
| Q |
111 |
ctatctctacattgtccctgaatattaaatttttctttcagcttggagtcgatactattccagtcctcgttggcccagtatcatacttgttgctctccaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832806 |
ctatctctacattgtccctgaatattaaatttttctttcagcttggagtcgatactattccagtcctcgttggcccagtatcatacttgttgctctccaa |
9832905 |
T |
|
| Q |
211 |
gcttgctaacggtgttgatccatcctttgatcttcttactctc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9832906 |
gcttgctaacggtgttgatccatcctttgatcttcttactctc |
9832948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 33469500 - 33469429
Alignment:
| Q |
139 |
atttttctttcagcttggagtcgatactattccagtcctcgttggcccagtatcatacttgttgctctccaa |
210 |
Q |
| |
|
|||| |||| ||||||||||| || ||| |||| || || |||||||| || |||||||||||||||||||| |
|
|
| T |
33469500 |
atttgtcttacagcttggagtagacactgttcccgttcttgttggccctgtttcatacttgttgctctccaa |
33469429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University