View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17213_low_12 (Length: 205)
Name: NF17213_low_12
Description: NF17213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17213_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 184
Target Start/End: Original strand, 33970512 - 33970685
Alignment:
| Q |
11 |
agtgagaagaacttgatgtgttgcaaggaatggttaataataatgtcctttgtcttgttcttggagtttctcctaccacatacagaatttaatagtgttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
33970512 |
agtgagaagaacttgatgtgttgcaaggaatggttaataataatgccctttgtcttgttcttgtagtttctcctaccacatacagaatttaatagtgatt |
33970611 |
T |
|
| Q |
111 |
tataaatcattataatatgcttaatcaagatcgagagttttgtgaagttcctatgaggcattgcatctatactc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33970612 |
tataaatcattataatatgcttaatcaagatcgagagttttgcgaagttcctatgaggcattgcatctatactc |
33970685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University