View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17213_low_8 (Length: 242)
Name: NF17213_low_8
Description: NF17213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17213_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 8766316 - 8766558
Alignment:
| Q |
17 |
agtgtgtagctttcaaaattgaaggagcacatgtattgtcttaggtttggctaggacaaggatcaaaataagatttttagtagtcaaatctttagaagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8766316 |
agtgtgtagctttcaaaattgaaggagcacatgtattgtcttaggtttggctaggacaaggatcaaaataagatttttagtagtcaaatctttagaagaa |
8766415 |
T |
 |
| Q |
117 |
gacgtgccgactataacataaagaaaacc-catattt----------------gattaatattttttcttaatggaccgtatatatagtttccaatgtgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8766416 |
gacgtgccgactataacataaagaaaaccacatctttcccctctagattactagattaatattttttcttaatggaccgtatatatagtttccaatgtgg |
8766515 |
T |
 |
| Q |
200 |
taacactctaactaatttcttaattggtagctcaaacttgttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8766516 |
taacactctaactaatttcttaattggtagctcaaacttgttt |
8766558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University