View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17214_low_12 (Length: 233)
Name: NF17214_low_12
Description: NF17214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17214_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 9855720 - 9855557
Alignment:
| Q |
18 |
ctccatctatagattcgttcatcagtttcttaaattaatcagtttgttgttgttaatgtagaaactataacttatatgcatagaaaaggaaaaggtttgt |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9855720 |
ctccatctatagatttgttcatcagtttctcaaattaatcagtttgttgttgttaatgtagaaactataacttatatgcatagaaaaggaaaaggtgtgt |
9855621 |
T |
|
| Q |
118 |
ctgatttaataaccctatatagtgggagtaggtttgtggtggaaaaatgactaggaagatgacc |
181 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
9855620 |
ctgattaaataaccctatatagtgggagtaggttcatggtgtaaaaatgactaggaagatgacc |
9855557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University