View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17214_low_4 (Length: 340)
Name: NF17214_low_4
Description: NF17214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17214_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 7952364 - 7952689
Alignment:
| Q |
1 |
ataataaacag-catatagataattaactcatagaacaaaattactcaaacaatgttcacattaatattgataataatatatatgacaaaccggtgctac |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7952364 |
ataataaacaggcatatagataattaactcatagaacaaaattactcaaacaatgttcgcattaatattgataataatatatatgacaaaccggtgctac |
7952463 |
T |
 |
| Q |
100 |
aattaaatacatttaattaatctcaaattctcaattgaccaatccacccatgagaaagcaaaacaattgaagtcagttatagctatctagctttgtcagc |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7952464 |
aattaaatacatttaatcaatctcaaattctcaattgaccaatccatccatgagaaagcaaaacaattgaagtcagttatagctatctagctttgtcagc |
7952563 |
T |
 |
| Q |
200 |
aaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagctcagccatggaccccaattgtgtctcaccttcaacactctcaagc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7952564 |
aaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagctcagccatggaccccaattgtgtctcaccttcaacactctcaagc |
7952663 |
T |
 |
| Q |
300 |
atccacaacaaatgttcaaacaaaac |
325 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7952664 |
atccacaacaaatgttcaaacaaaac |
7952689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 158 - 325
Target Start/End: Original strand, 7936585 - 7936755
Alignment:
| Q |
158 |
caaaacaattgaagtcagt---tatagctatctagctttgtcagcaaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagc |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||| || | | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7936585 |
caaaacaattgaagtcagtcactatagctatcaagttgtattagcaaaacatgatcaaattcatgatcaacatgcaccacaattgtagaactcaaccagc |
7936684 |
T |
 |
| Q |
255 |
tcagccatggaccccaattgtgtctcaccttcaacactctcaagcatccacaacaaatgttcaaacaaaac |
325 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
7936685 |
tcagccatggaccccaactgtgtctcaccttcaacactttcaagcatccacagcaaatgttcaaacaaaac |
7936755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University