View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_high_15 (Length: 460)
Name: NF17215_high_15
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 8e-96; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 8e-96
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 54543784 - 54543564
Alignment:
| Q |
16 |
atctgaaactgtactcttccatttctcgtcttatcagtttgtgttcttttatttcttcaacttagcaaatgtctggatgcaacattcaaaccttgctggc |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54543784 |
atctgaaactgtactcttccatttctcttcttatcagtttgtgttcttttatttcttcaactt-gcaaatgtctggatgcaacattcaaaccttgctggc |
54543686 |
T |
 |
| Q |
116 |
ctaccactccctgactggtgtgtatctaccgcgtannnnnnnngcaaacttctggttttgcttcgttcacaactaattcctatttatagtgctctctttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54543685 |
ctaccactccctgactggtgtgtatctcccgcgtattttttttgcaaacttctggttttgcttcgttcataactaattcctatttatagtgctctctttg |
54543586 |
T |
 |
| Q |
216 |
ccggctactggtgttgtttcag |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54543585 |
ccggctactggtgttgtttcag |
54543564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 291 - 380
Target Start/End: Complemental strand, 54543520 - 54543431
Alignment:
| Q |
291 |
tgtgtttggcagttggtttttgccttctgtcaataggatctgaaagttgcagttgtgnnnnnnnggttgttattgtcgtgcgcatggggc |
380 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
54543520 |
tgtgattggcagttggtttttgccttctgtcaataggatctgaaagttgcagctgtgtttttttggttgttattgtcgtgcgcatggggc |
54543431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Complemental strand, 54543433 - 54543404
Alignment:
| Q |
415 |
ggcaggggtatgcttttgtttggtgtaaag |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54543433 |
ggcaggggtatgcttttgtttggtgtaaag |
54543404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University