View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_high_42 (Length: 277)
Name: NF17215_high_42
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 5 - 265
Target Start/End: Complemental strand, 8556576 - 8556316
Alignment:
| Q |
5 |
acaacctgtttctgtacaaagtctttgacttcttcagcatcaggattttcaagccaacggtaagggtcgggaacattaacgccgtgatagttgtcaatga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556576 |
acaacctgtttctgtacaaagtctttgacttcttcagcatcaggattttcaagccaacggtaagggtcgggaacattaacgccgtgatagttgtcaatga |
8556477 |
T |
 |
| Q |
105 |
cggagtcgtttctgcgagcaatgggatattggatggtttcatcaaacacagaaagtgaacccatttttcttctatagctgttattgttaagagaagaaga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556476 |
cggagtcgtttctgcgagcaatgggatattggatggtttcatcaaacacagaaagtgaacccatttttcttctatagctgttattgttaagagaagaaga |
8556377 |
T |
 |
| Q |
205 |
gtaatgagatttgaataatgtgttggtggtaaataaacgaggaagaaagtttgggtatctg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556376 |
gtaatgagatttgaataatgtgttggtggtaaataaacgaggaagaaagtttgggtatctg |
8556316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 8552246 - 8552188
Alignment:
| Q |
1 |
caacacaacctgtttctgtacaaagtctttgacttcttcagcatcaggattttcaagcc |
59 |
Q |
| |
|
||||||||||||||| || || || |||||||||||||| || |||||||||||||||| |
|
|
| T |
8552246 |
caacacaacctgtttttgcacgaactctttgacttcttctgcgtcaggattttcaagcc |
8552188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University