View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_high_45 (Length: 251)
Name: NF17215_high_45
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 7166828 - 7166608
Alignment:
| Q |
16 |
ataatgtaagagtgtgttttgactagagatttcaaaattcaaggaaattgatgggtttatatacacacacattttggtatgcagaaaacttgaagaaggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166828 |
ataatgtaagagtgtgttttgactagagatttcaaaattcaaggaaattgatgggtttatatatacacacattttggtatgcagaaaacttgaagaaggt |
7166729 |
T |
 |
| Q |
116 |
gagtcatttgttagaactgccaggtgcaaagggcaaactgtccctttggaaggctgaccttggggaagagggtagttttgatgaagctattaaagggtgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166728 |
gagtcatttgttagaactgccaggtgcaaagggcaaactgtccctatggaaggctgaccttggtgaagagggtagttttgatgaagctattaaagggtgt |
7166629 |
T |
 |
| Q |
216 |
acaggagtttttcatgttgct |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7166628 |
acaggagtttttcatgttgct |
7166608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 94 - 236
Target Start/End: Complemental strand, 7160192 - 7160050
Alignment:
| Q |
94 |
atgcagaaaacttgaagaaggtgagtcatttgttagaactgccaggtgcaaagggcaaactgtccctttggaaggctgaccttggggaagagggtagttt |
193 |
Q |
| |
|
||||||| ||| |||||||||||| |||||||| ||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7160192 |
atgcagataacatgaagaaggtgaagcatttgttggaactgccaggtgcaaatagcaaactatctctttggaaggctgaccttggggaagagggtagttt |
7160093 |
T |
 |
| Q |
194 |
tgatgaagctattaaagggtgtacaggagtttttcatgttgct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7160092 |
tgatgaagctattaaagggtgtacaggagtttttcatgttgct |
7160050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University