View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_high_47 (Length: 241)
Name: NF17215_high_47
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 25256203 - 25256404
Alignment:
| Q |
23 |
gtcagtattgtgtctagtattcgtgtcagtattttgattttccaatccaatatccaacnnnnnnngtaatttaaataaattcatacaagaggttgaaaaa |
122 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25256203 |
gtcagtattgtgtctggtattcgtgtcggtattttgattttccaatccaatatccaactttttttgtaatttaaataaattcatacaagaggttgaaaaa |
25256302 |
T |
 |
| Q |
123 |
gtggcatactcactctatccatgttacacagaagaaaagcagagaagcaaagaataacaataacccatctcttaggaaaaacttcccaccaaggtgaaga |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25256303 |
gtggcatactcactctgtccatgttacacagaagaaaagcagagaagcaaagaataacaataacccatctcttaggaaaaacttcccaccaagatgaaga |
25256402 |
T |
 |
| Q |
223 |
ct |
224 |
Q |
| |
|
|| |
|
|
| T |
25256403 |
ct |
25256404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University