View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_high_48 (Length: 238)
Name: NF17215_high_48
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_high_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 138 - 232
Target Start/End: Complemental strand, 12730306 - 12730212
Alignment:
| Q |
138 |
ttcaatatatcaaccaagttgtatttatacattttagttgatagaacattaattaaatatcttaacataagtaatctgatcgacttcatctcact |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||| ||||||| |||||||||||| |||||||||||||||||| || ||||| |
|
|
| T |
12730306 |
ttcaatatatcaacgaagttgtatttatacactttagttgatagagcattaatgaaatatcttaacccaagtaatctgatcgactttatatcact |
12730212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 146
Target Start/End: Complemental strand, 12730692 - 12730650
Alignment:
| Q |
104 |
ttgagaacacacttagagcttaaatttatatcctttcaatata |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12730692 |
ttgagaacacacttagagcttaaatttatatcctttcaatata |
12730650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University