View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_low_2 (Length: 761)
Name: NF17215_low_2
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 473 - 743
Target Start/End: Original strand, 33435255 - 33435525
Alignment:
| Q |
473 |
cgacaaggtttttctcatcatcattgtttacattccttgcaaccacattggccacgaaaacatgtagacaaagcaataacaataaagccactttcttgtt |
572 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435255 |
cgacaaggtttttctcatcatcattgtttacattccttgcaaccacattgaccacgaaagcatgtagacaaagcaataacaataaagccactttcttgtt |
33435354 |
T |
 |
| Q |
573 |
ccctagcaacatctttactatatcaaatcactcacactttctatttgatatctatcctggttggtgtagtatgcataagctaacatgaggcttttataac |
672 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435355 |
ccctagcaacatctttactatatcaaatcactcacactttctatttgatatctatcctggttggtgtagtatgcataagctaacatgaggcttttataac |
33435454 |
T |
 |
| Q |
673 |
ccggaagaggatatatgttatactatgttggcccctctatcactttaattggtttcaactactaacaatag |
743 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435455 |
ccggaagaggatatatgttatactatgttggcccctctatcactttaattggtttcaactactaacaatag |
33435525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University