View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_low_37 (Length: 321)
Name: NF17215_low_37
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 14 - 182
Target Start/End: Complemental strand, 47334074 - 47333908
Alignment:
| Q |
14 |
aaaatgaaaatagatactaaacctgtgacgaatgaaaaaattgatgtgatnnnnnnntgatgaaaagttggctgctttcactgcagaccaacctcttgtc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47334074 |
aaaatgaaaatagatactaaacctgtgacgaatgaaaaaattgatgtgataaaaaaatgatgaaaagttggctgctttcactgcagaccaacctcttgtc |
47333975 |
T |
|
| Q |
114 |
tggtgggacgtttcattttatttttgtcgcaattcttaacactattttataggaatcccttttaagaat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
47333974 |
tggtgggacgtttcattttatttttgtcacaattc-taacatta-tttataggaatcccttttaagaat |
47333908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 208 - 321
Target Start/End: Complemental strand, 47333817 - 47333708
Alignment:
| Q |
208 |
ttctaatctcaattacagaagaatacaaatttgtgactaaattaacnnnnnnnattacattataattataataaaaatcgtaagtacaccaatatcatga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
47333817 |
ttctaatctcaattacagaagaatacaaatttgtgactaaattaacttttt---ttttatta-cactataataaaaatagtaagtacaccaatatcatga |
47333722 |
T |
|
| Q |
308 |
ttgtcgtgattgca |
321 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47333721 |
ttgtcgtgattgca |
47333708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University