View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17215_low_49 (Length: 238)
Name: NF17215_low_49
Description: NF17215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17215_low_49 |
 | |
|
| [»] scaffold0189 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0189 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 23734 - 23955
Alignment:
| Q |
1 |
ttttctgaattctgtcaggtacagtctttattgcatatctatgaggtctcaaaatttcttctcaagtctaaatgttttagccatggacacggtaacttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23734 |
ttttctgaattctgtcaggtacagtctttattgcatatctatgaggtctcaaaatttcttctcaagtctaaatgttttagccatggacacggtaacttga |
23833 |
T |
|
| Q |
101 |
aaacattggaaacattttacagaacgccaattgagtgtttattccaccttctagtcccccttgactggaagaaaacactgacaaaagaaatgttttatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23834 |
aaacattggaaacattttacagaacgccaatcgagtgtttattccaccttctagtcccccttgactggaagaaaacactgacaaaagaaatgttttatct |
23933 |
T |
|
| Q |
201 |
aagggaaactgaagcttgtcag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
23934 |
aagggaaactgaagcttgtcag |
23955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 28403379 - 28403596
Alignment:
| Q |
1 |
ttttctgaattctgtcaggtacagtctttattgcatatctatgaggtctcaaaatttcttctcaagtctaaatgttttagccatggacacggtaacttga |
100 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||| ||||| ||||||| |
|
|
| T |
28403379 |
ttttccgaattctgtcgagtacagcctttattgcatatctatgaggtctcaaaatttcttctcaagttcaagtgttttaaccatggccacggcaacttga |
28403478 |
T |
|
| Q |
101 |
aaacattggaaacattttacagaacgccaattgagtgtttattccaccttctagtcccccttgactggaagaaaacactgacaaaagaaatgttttatct |
200 |
Q |
| |
|
|||||||||| | |||||||||| |||||||||| || || |||||| | || ||||| |||||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
28403479 |
aaacattggagagattttacagacagccaattgagagtgtactccaccacgttgttcccctggactggaagaaatcactggcaaaagaaatggtttatca |
28403578 |
T |
|
| Q |
201 |
aagggaaactgaagcttg |
218 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
28403579 |
aaggataactgaagcttg |
28403596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University