View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_high_22 (Length: 391)
Name: NF17216_high_22
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 86 - 381
Target Start/End: Complemental strand, 609558 - 609281
Alignment:
| Q |
86 |
ccgacacatgttgttgagtgtatagagaaggaagaaaatggttggaaagttgagagtgaagtgaaaatggagaggtatgagaggggaagtagaagaagga |
185 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609558 |
ccgacacgtgttgttgagtgtatagagaaggaagaaaatggttggaaagttgagagtgaagtgaaaatggagaggtatgagaggggaagtagaagaagga |
609459 |
T |
|
| Q |
186 |
gatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaattggggtgaacctctttggcttgcattggcaacttcttgaaaactctcatttggatc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609458 |
gatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaattggggtgaacctctttggcttgcattggcaacttcttgaaaactctcatttg---- |
609363 |
T |
|
| Q |
286 |
tttgtctctctatctattatttaacaatgatcatgtaaaacaannnnnnnnagaatttttaggtatctgttctttttcttctgaatatcccctttg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
609362 |
--------------aattatttaacaatgatcatgtaaaacaattttttttagaatttttaggtatctgttctttttcttctgaatatcccttttg |
609281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 609648 - 609583
Alignment:
| Q |
20 |
gctccctcggtctccccaacaaaagaagaggagagtgtgaaggaagtagtagaagaagaaggtatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609648 |
gctccctcggtctccccaacaaaagaagaggagagtgtgaaggaagtagtagaagaagaaggtatt |
609583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University