View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_high_42 (Length: 246)
Name: NF17216_high_42
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 24331257 - 24331044
Alignment:
| Q |
13 |
tacttaagttagcacccnnnnnnnngattagcaccaagaaaaattatagtacttcagttacactttactatggtgagcacgtgaaaaatttatgtatggt |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24331257 |
tacttaagttagcacccaaaaaaaagattagcaccaagaaaaattatagtacttcagttacactttactatggtgagcacgtgaaaaatttatgtatggt |
24331158 |
T |
 |
| Q |
113 |
caatttgaactttctcttgaacatttaataccnnnnnnnnnnnnnnnaagtcttttggggggtcaacattctttttagaggttcactaccctaccaccca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24331157 |
caatttgaactttctcttgaacatttaatacc----tttttttttttaagtcttttggggggtcaacattctttttagaggttcactaccctaccaccca |
24331062 |
T |
 |
| Q |
213 |
agaaaggatatttttagt |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24331061 |
agaaaggatatttttagt |
24331044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University