View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_high_44 (Length: 229)
Name: NF17216_high_44
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_high_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 11 - 211
Target Start/End: Original strand, 19142830 - 19143029
Alignment:
| Q |
11 |
tacaactatggtaaaatggttgcaaaatatggaagtgggttggcctagaagagaggtatttatggactgagaatagaccttccaacaattagccaactca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19142830 |
tacaactatggtaaaatggttgcaaaatatggaagtgggttggcctagaagagaggtatttatggactgagaatagaccttccaacaattagccaactca |
19142929 |
T |
|
| Q |
111 |
caattcaaatttaacttctcgtgttggagaattaaagaagnnnnnnnnngaaataagagggtgacttgatattcacctttcaatctccattaaccattca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19142930 |
caattcaaatttaacttctcgtgttggagaattaaagaag-aaaaaaaagaaataagagggtgacttgatattcacctttcaatctccattaaccattca |
19143028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University