View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_high_45 (Length: 225)
Name: NF17216_high_45
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 73 - 152
Target Start/End: Original strand, 5192192 - 5192271
Alignment:
| Q |
73 |
acgacggtttccgacgacttgaattaaccggcgaagttgctccttcagaagccattccacactgcatctagttttattaa |
152 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5192192 |
acgatggtttctgacgacttgaattaaccggcgaagtttctccttcagaagccattccacactgcatctagttttattaa |
5192271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5192588 - 5192640
Alignment:
| Q |
157 |
gtgagttgagttggtgggtctaacattgaaacctcaccaccgaccacacctcc |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5192588 |
gtgagttgaattggtgggtctaacattgaaacctcaccaccgaccacacctcc |
5192640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 5192101 - 5192145
Alignment:
| Q |
1 |
atttttggcacttataaattatacccctcatttttgctgttataa |
45 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
5192101 |
atttttggcacttatcaattatacccctcatttttgccgttataa |
5192145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 73 - 137
Target Start/End: Complemental strand, 52229583 - 52229519
Alignment:
| Q |
73 |
acgacggtttccgacgacttgaattaaccggcgaagttgctccttcagaagccattccacactgc |
137 |
Q |
| |
|
||||||| ||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
52229583 |
acgacggcttccgacgacttgaattcgccgccgaagttgctccgtcagaagccattccacactgc |
52229519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University