View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_low_16 (Length: 457)
Name: NF17216_low_16
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 24331551 - 24331677
Alignment:
| Q |
124 |
tagtatattagtcatatgtcttgtgttgttacacgtgacataataagaatccagcacccaaactgttaattagtagagactataatgagaacaattgggg |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24331551 |
tagtatattagtcatatgtcttatgttgttacacgtgacataatgagaatccagcacccaaactgttaattagtagagactataatgagaacaattgggg |
24331650 |
T |
|
| Q |
224 |
ccatctagttgttgctgcttctgtttc |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24331651 |
ccatctagttgttgctgcttctgtttc |
24331677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 24331298 - 24331422
Alignment:
| Q |
1 |
aggtaattatatgtaattttgtgacaatcaagtcaagtaaaagtaattatatgtcccttgcagacttcaaaatttactgactttccctaatcttgagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24331298 |
aggtaattatatgtaattttgtgacaatcaagtcaagtaaaagtaattatatgtccctagcagacttcaaaatttactgactttccctaatcttgagatt |
24331397 |
T |
|
| Q |
101 |
gcacctgttgtgttcttaataacta |
125 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
24331398 |
gcacctgttgtgtttttaataacta |
24331422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 408
Target Start/End: Original strand, 24331790 - 24331835
Alignment:
| Q |
363 |
caatatagatagtataattttgttttttgttacatgaaaaaaggat |
408 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
24331790 |
caatatagatagtatacttttgttttttgttacatgaagaaaggat |
24331835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University