View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_low_29 (Length: 348)
Name: NF17216_low_29
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 21 - 340
Target Start/End: Complemental strand, 26777261 - 26776942
Alignment:
| Q |
21 |
atacttgtccaagaaactggtccaataccataagccatctatccgggagtgcaattccgtcctcctataggttgcccgatcctatgagcagcataagctc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26777261 |
atacttgtccaagaaactggtccaataccataagccatctgtccgggagtgcaattccgtcctcctataggttgcccgatcctatgagcagcataaactc |
26777162 |
T |
 |
| Q |
121 |
caactccagaaggcggggttgcaacatacattccggcacgtggagctggtggatcatttaaagttctggtaccagcagatggagcttgaggagtttgtgt |
220 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777161 |
cgactccagaaggcggggtcacaacatacattccggcaggtggaactggtggatcatttaaagttctggtaccagcagatggagcttgaggagtttgtgt |
26777062 |
T |
 |
| Q |
221 |
ggctgattttctggcagaatcgcttgcttgatcggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggat |
320 |
Q |
| |
|
|||||||| ||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777061 |
ggctgattgtcttgcataatcacttgcttgaccggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggat |
26776962 |
T |
 |
| Q |
321 |
cgccttctttctttcttctc |
340 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26776961 |
cgccttctttctttcttctc |
26776942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 234 - 340
Target Start/End: Original strand, 26553800 - 26553906
Alignment:
| Q |
234 |
gcagaatcgcttgcttgatcggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctt |
333 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||| ||||||||||||||||||||||||| |||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26553800 |
gcagaattgcttgcttgaccggtaattggtccttgaggtgctgaaatgtctccatttttgacaaaggtgacatcatgtatgctggatcgccttctttctt |
26553899 |
T |
 |
| Q |
334 |
tcttctc |
340 |
Q |
| |
|
||||||| |
|
|
| T |
26553900 |
tcttctc |
26553906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 112
Target Start/End: Original strand, 26553666 - 26553699
Alignment:
| Q |
79 |
gtcctcctataggttgcccgatcctatgagcagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
26553666 |
gtcctcctataggttgcccgatcctaggagcagc |
26553699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University