View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_low_44 (Length: 240)
Name: NF17216_low_44
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 42 - 140
Target Start/End: Complemental strand, 19143334 - 19143236
Alignment:
| Q |
42 |
tgatgtagggtacagtttcagggtggaaacaaatgtactatctagacattctttggagtaaaaagccaaatatttcaaaatcctaatcaaaatgtcttc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19143334 |
tgatgtagggtacagtttcagggtggaaacaaatgtactatctagacattctttggagtaaaaagccaaatatttcaaaatcctaatcaaaatgtcttc |
19143236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 232
Target Start/End: Complemental strand, 19143181 - 19143146
Alignment:
| Q |
197 |
ttgtagcttgagaattttgcgtgtaaacttttatat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19143181 |
ttgtagcttgagaattttgcgtgtaaacttttatat |
19143146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University