View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17216_low_45 (Length: 233)
Name: NF17216_low_45
Description: NF17216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17216_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 48960492 - 48960295
Alignment:
| Q |
16 |
aatatggaagaggctgtgttttatttatagaacagttttcacctcataggacagaagaacaatgatgagtttaaaacacaagttgtcgcaggtaggaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48960492 |
aatatggaagaggctgtgttttatttatagaacagttttcacctcataggacagaagaacaatgatgagtttaaaacacaagttgtcgcaggtaggaaaa |
48960393 |
T |
 |
| Q |
116 |
gnnnnnnnngtgaatat-atataatagaccatgaattcgagacatgacccgtataaaattaaagaaatggggaaaagcatcggattcaattggcacttcc |
214 |
Q |
| |
|
| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48960392 |
g-aaaaaaagtgaatataatataatagaccatgaattcgagacatgacccgtataaaattaaagaaatgggg-aaagcatcggattcaattggcacttcc |
48960295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University