View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17217_high_15 (Length: 259)
Name: NF17217_high_15
Description: NF17217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17217_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 39137799 - 39137552
Alignment:
| Q |
7 |
tgagatgaaatttcataatcttactatgagaatactgtttaatttgattaactaattgatcaataaaaaatattcttctcacctatagtttatgcagtta |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39137799 |
tgagctgaaatttcataatcttactatgagaatactgtttaatttgattaactaattgatcaataaaaaatattcttctcacctatagtttatgcagtta |
39137700 |
T |
 |
| Q |
107 |
atttttatttac---------------ttcaaagatattgaaaaatcacagtactaataaaatacatgttttcttttatctaattgattgattagtaaag |
191 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39137699 |
atttttatttacggcatatttatttacttcaaagatattgaaaaatcacagtactaataaaatacatgttttcttttatctaatt----gattagtaaag |
39137604 |
T |
 |
| Q |
192 |
tgcagtcttctaactaattgagtattgaaaagcaggtatcatgtatatgatt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39137603 |
tgcagtcttctaactaattgagtattgaaaagcaggtatcatgtatatgatt |
39137552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University