View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17217_high_17 (Length: 254)
Name: NF17217_high_17
Description: NF17217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17217_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 56542849 - 56543072
Alignment:
| Q |
12 |
atgaattagtagtataaagaggtattagttgtttgtttctaacacaaggaagttctgatctcaccagtcaccgcgaagagagtttttcagcgcaattgtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
56542849 |
atgaattagtagtataaagaggtattagttgtttgtttctaacacaaggaagttctgatctcaccagtcaccacgaagagagtttttcagcacaattgtg |
56542948 |
T |
|
| Q |
112 |
atgtccgtggtagttttaatgcaaaaccaaacacctttcatgaggcgccgcagaagaaagttttctaacttttccaagatggagtgcgaaaacagtctcg |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56542949 |
atgtccgtggttgttttaatgcaaaaccaaacacctttcatgaggcgccgcagaagaaagttttctaacttttccaagatggagtgcgaaaacagtctcg |
56543048 |
T |
|
| Q |
212 |
ggcgttggttatgccggaatagac |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
56543049 |
ggcgttggttatgccggaatagac |
56543072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 9883614 - 9883568
Alignment:
| Q |
15 |
aattagtagtataaagaggtattagttgtttgtttctaacacaagga |
61 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
9883614 |
aattagtaatataaagtggtattagttgttagtttctaacacaagga |
9883568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 61
Target Start/End: Original strand, 20422581 - 20422627
Alignment:
| Q |
15 |
aattagtagtataaagaggtattagttgtttgtttctaacacaagga |
61 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
20422581 |
aattagtaatataaagtggtattagttgttagtttttaacacaagga |
20422627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University