View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17218_high_13 (Length: 363)
Name: NF17218_high_13
Description: NF17218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17218_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 18411346 - 18411070
Alignment:
| Q |
1 |
aactattaatctattaaacaaagtataactataaaatacttataaaaacatgttatcaagtaatttggtggctaaatagtcttgagtatttacta--aca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
18411346 |
aactattaatctattaaacaaagtataactataaaatacttataaaaacatgttatcaagtaatttggtggctaagtagtcttgagtatttactataaca |
18411247 |
T |
 |
| Q |
99 |
atctcccacttgaagaataatttcaatttaccttcgcaaatcgatcactgaacaatctttactagtttgctaactaagttgatcagcacacttgcagttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18411246 |
atctcccacttgaagaataatttcaattcaccttcacaaatcgatcacagaacaatcttcactagtttgctaactaagttgatcagcacacttgcagttt |
18411147 |
T |
 |
| Q |
199 |
gttgatgcttgccacttttgtcaacatgtttgttgggctcattcttccttcaatcttctttaatggtagcacttcat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18411146 |
gttgatgcttgccacttttgtcaacatgtttgttgggctcattcttccttcaatcttctttaatgttagcacttcat |
18411070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 278
Target Start/End: Original strand, 37912849 - 37912931
Alignment:
| Q |
196 |
tttgttgatgcttgccacttttgtcaacatgtttgttgggctcattcttccttcaatcttctttaatggtagcacttcatcct |
278 |
Q |
| |
|
||||| |||| || |||||||| ||||||||||||||| | || | |||| |||||||||||| |||| |||||| ||||||| |
|
|
| T |
37912849 |
tttgtcgatggttaccacttttctcaacatgtttgttgaggtcctacttctttcaatcttcttcaatgttagcacctcatcct |
37912931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University