View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17218_high_25 (Length: 243)
Name: NF17218_high_25
Description: NF17218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17218_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 233
Target Start/End: Original strand, 33934450 - 33934664
Alignment:
| Q |
14 |
cactctttatcttggtcttaggcttcgtggtggcattgtcgaaccttctttgatggctttggcttggaaattgaaccaagacataaccatttgctactag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33934450 |
cactctttatcttggtcttaggcttcgtggtggcattgtcgaaccttctttgatggctttggcttggaaattgaacaaagacataaccatttgctactag |
33934549 |
T |
|
| Q |
114 |
tggtgctacgcatgtcttcatcctatggctgtgaaaggaaatgtggacacaacacaacaatcaattgaggccaaacaagaagatcaagtaggctccggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33934550 |
tggtgctacgcatgtcttcatcctatggctgtgaaaggaaatgtgg-----acacaacaatcaattgaggccaaacaagaagatcaagtaggctccggtt |
33934644 |
T |
|
| Q |
214 |
gatattctttctttcctatg |
233 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
33934645 |
gatattctttctttcttatg |
33934664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 84
Target Start/End: Original strand, 25948759 - 25948810
Alignment:
| Q |
33 |
aggcttcgtggtggcattgtcgaaccttctttgatggctttggcttggaaat |
84 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
25948759 |
aggcttcgtggtggtattatcgagccttctttgatggctttggctaggaaat |
25948810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 96
Target Start/End: Complemental strand, 42609479 - 42609398
Alignment:
| Q |
15 |
actctttatcttggtcttaggcttcgtggtggcattgtcgaaccttctttgatggctttggcttggaaattgaaccaagaca |
96 |
Q |
| |
|
|||||| |||| | ||| ||||||||||| || || | ||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
42609479 |
actcttcatctcgttctcaggcttcgtgggggtatcattgaaccttctttgatggctttggcaaggaaatacaaccaagaca |
42609398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University